 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circEPSTI1 | |||
| Gene | EPSTI1 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Breast Cancer | ICD-10 | Malignant neoplasm of breast (C50) |
| DBLink | Link to database | PMID | 30083277 |
| Experimental Method | |||
| Sample Type | Tissues and Cell lines | Comparison | tumor tissues and their adjacent normal mammal tissues from TNBC patients |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward AAGCTGAAGAAGCTGAACTC ReverseGTGTATGCACTTGTGTATTGC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Chen, B, Wei, W, Huang, X, Xie, X, Kong, Y, Dai, D, Yang, L, Wang, J, Tang, H, Xie, X (2018). circEPSTI1 as a Prognostic Marker and Mediator of Triple-Negative Breast Cancer Progression. Theranostics, 8, 14:4003-4015. | |||